αsyn primers  (OriGene)

Journal: bioRxiv

Article Title: Neural cell state modulation by PARK2 and dopaminergic neuroprotection by small molecule Parkin agonism

doi: 10.64898/2026.04.01.715918

Figure Lengend Snippet: ( a ) Single cell sequencing results and unsupervised clustering of WT cells (Parental1, Parental2, Parental Bulk)(n=3) and KO cells (KO1, KO2)(n=2). Four primary clusters are identified that correspond to population types shown in the legend at the bottom. Colors indicate cell types. ( b ) Parkin loss alters the relative ratio of cell types following differentiation induction. Frequency of resulting cellular types from differentiation in each genotype is shown as a stacked bar plot for each sample. ( c ) Parkin KO results in alterations in transcription factors related to neuronal cell state. DecoupleR analysis was performed on differentially expressed genes between WT and KO neuronal-like cells. DecoupleR TF scores are plotted for each genotype. ( d ) Examples of Parkin KO-induced alterations in the expression of genes important for each cell type. Differential expression was performed to identify the top and bottom 5 genes by log2FC. Data shown as dot plots with the size of each dot representing the cell percentage expressing the gene, and the color scale indicating the average normalized expression level. ( e ) GSEA analysis of differentially expressed genes between KO neuronal cells and WT neuronal cells (x-axis represents the normalized enrichment score; dot size shows the gene set size; color shows p-value). ( f ) Genes from the gene ontology set Ribosome Assembly were selected, and the Log2FC is shown for KO vs WT cells as shown. Each row represents the KO vs WT comparison for the indicated cell type. ( g ) Chemical Structure of compound FB231. ( h ) Concentration of FB231 in the plasma of rats with IV and IP administration. Rats were treated with intravenous injection (1 mg/kg) and i.p. injection (3 mg/kg). ( i ) Immunoprecipitation (IP) of Parkin constructs. T98G cells were transfected with either pcDNA3.1 empty vector (EV) or with vector encoding WT Parkin. Cell lysates were prepared and immunoprecipitated with anti-Parkin antibody. ( j ) FB231 promotes Parkin activity to ubiquitinate cyclin D in vitro. Using Parkin IP, in vitro ubiquitination assay was performed. Different concentrations of compound FB231 were added in the indicated reactions. ( k ) Compound FB231 promotes Parkin activity to ubiquitinate αSyn in vitro. Using the above Parkin-pulled-down solution , an in vitro ubiquitination assay was performed, followed by a Western blot. Different concentrations of compound FB231 were added as indicated.

Article Snippet: Finally, αSyn primers (Origene, HP200326) had the following sequence for forward and reverse primers, respectively: ACCAAACAGGGTGTGGCAGAAG and CTTGCTCTTTGGTCTTCTCAGCC.

Techniques: Single Cell, Sequencing, Expressing, Quantitative Proteomics, Comparison, Concentration Assay, Clinical Proteomics, Injection, Immunoprecipitation, Construct, Transfection, Plasmid Preparation, Activity Assay, In Vitro, Ubiquitin Proteomics, Western Blot

Journal: Nature Communications

Article Title: Discovery of NIRF theranostic probes targeting amyloid-β and cholinesterases in Alzheimer’s disease models

doi: 10.1038/s41467-025-68282-3

Figure Lengend Snippet: a Schematic representation of the incubation of monomeric Aβ 1-40 peptides (10 µM) under various experimental conditions: without I-43 (i), with twofold of I-43 (ii), and with fourfold of I-43 (iii), all incubated for 72 h. TEM micrographs (i–iv) illustrate that the presence of I-43 at concentrations of 20 and 40 μM, relative to Aβ (10 μM), slows down aggregation to small fragments compared to the control (i.e., without I-43). b ThT fluorescence spectra used to monitor the transition of monomeric Aβ 1-40 peptides into aggregated forms. Spectral data ( b1 and b2 ) include ThT fluorescence emission spectra and corresponding bar graphs for the following conditions: (i) ThT alone (20 μM); (ii) ThT + Aβ 1-40 (2:1, 72 h); (iii) ThT + Aβ 1-40 + I-43 (2:1:4, 72 h); and (iv) ThT + Aβ 1-40 + I-43 (2:1:2, 72 h) in PBS (pH 7.4). Data points are mean ± SEM ( n = 3 independent experiments in triplicate) and ****p < 0.0001. b3 shows ThT-based aggregation kinetics, depicting the time-dependent conversion of monomeric Aβ 1-40 peptides into aggregates in the presence or absence of I-43 over 72 h (mean ± SD, n = 3 indepe n dent experiments in triplicate), and ****p < 0.0001. c , d Comparative analysis of fluorescence intensity changes (Fl spectral and bar graph) of I-43 (10 μM) following incubation with monomeric and fibrillar forms of recombinant tau and α-synuclein (5 μM), relative to Aβ 1-42 and Aβ 1-40 fibrils (5 μM). Data are presented as mean ± SD ( n = 3 independent experiments in triplicate). Statistical significance was determined using one-way ANOVA followed by Dunnett’s post hoc test, and ****P < 0.0001. e , f FMOs and electrostatic potential maps of I-43 obtained from DFT-optimized geometries (Gaussian16). g MTT assay in PC12 cells shows mean ± SEM ( n = 3 independent experiments in quadruplicate; statistical outliers excluded). Source data are provided as a Source Data file.

Article Snippet: For α-synuclein aggregates, E. coli -derived human α-synuclein protein (Met1-Ala140, Cat. No. SP-485-500, batch: DRDU0223121, R&D Systems) was used following a reported protocol with minor modifications .

Techniques: Incubation, Control, Fluorescence, Recombinant, MTT Assay

Journal: Nature Communications

Article Title: Discovery of NIRF theranostic probes targeting amyloid-β and cholinesterases in Alzheimer’s disease models

doi: 10.1038/s41467-025-68282-3

Figure Lengend Snippet: a Paraffin-embedded AD brain sections showed Aβ-positive puncta stained with known standards (ThT, CRANAD-2, and Congo Red). Counterstaining with I-43 revealed high colocalization with these dyes, especially in mature plaques. CAA-associated deposits visualized by Congo Red were also effectively labeled by I-43. b–e Confocal images of AD patient brain tissues co-stained with I-43 (NIR channel) and anti-Aβ antibodies (D54D2, 6E10, OC, and A11; green channel). c1 and d1 Semiquantitative fluorescence intensity analysis of regions of interest (ROIs) determined using ImageJ. Data represent mean ± SD. In panel c1, n = 12; two-tailed unpaired t test ( ns P = 0.466). In panel d1 , n = 9; one-way ANOVA with Dunnett’s post hoc test ( ****P < 0.0001, and *P = 0.0402). f IHC confocal images of PD striatum showing α-Synuclein deposits (pSer129α-Syn antibody); I-43 counterstaining showed no colocalization. g Confocal images of AD and FTD brain sections revealed mature tau tangles (Tau46, AT8 antibodies) with no detectable NIR signal from I-43 in tau-positive puncta. h Confocal images showing CAA-associated staining in the green (OC antibody) and NIR (I-43) channels. Imaging was performed on an LSM 780 (Axio Imager 2) using FITC, TRITC, and 700 nm emission filters for ThT, CRANAD-2, and I-43, respectively. Scale bar: 20 µm. i Confocal images of larval imaginal discs from WT (Oregon R⁺; panels i1 – i2 ) and AD ( ey -GAL4-UAS-Aβ42/CyO; panels i3 – i4 ) flies stained with I-43 ( n ≥ 10). Panels i2 and i4 are 40× magnifications of panels i1 and i3 , respectively (scale bars: 50 µm for i1 / i3 ; 20 µm for i2 / i4 ; λ em = 700 nm; LSM 780). An orthogonal view from panel i4 reveals discrete amyloid plaques. j Fluorescence images of adult WT ( j1-j2 ) and AD ( j3-j4 ) fly eyes after feeding with I-43 (10 µM), acquired at 20× magnification using a NIS-Elements BR microscope (scale bar, 100 µm). White circles indicate ROIs used for fluorescence intensity quantification (red channel). k Semiquantitative fluorescence intensity plot of I-43 in the eyes of WT vs AD flies ( n ≥ 10, mean ± SD, ****P < 0.0001 compared to WT, analyzed by two-tailed unpaired t -test). Source data are provided as a Source Data file.

Article Snippet: For α-synuclein aggregates, E. coli -derived human α-synuclein protein (Met1-Ala140, Cat. No. SP-485-500, batch: DRDU0223121, R&D Systems) was used following a reported protocol with minor modifications .

Techniques: Staining, Labeling, Fluorescence, Two Tailed Test, Imaging, Microscopy

Journal: Nature Communications

Article Title: Discovery of NIRF theranostic probes targeting amyloid-β and cholinesterases in Alzheimer’s disease models

doi: 10.1038/s41467-025-68282-3

Figure Lengend Snippet: a Schematic representation of the incubation of monomeric Aβ 1-40 peptides (10 µM) under various experimental conditions: without I-43 (i), with twofold of I-43 (ii), and with fourfold of I-43 (iii), all incubated for 72 h. TEM micrographs (i–iv) illustrate that the presence of I-43 at concentrations of 20 and 40 μM, relative to Aβ (10 μM), slows down aggregation to small fragments compared to the control (i.e., without I-43). b ThT fluorescence spectra used to monitor the transition of monomeric Aβ 1-40 peptides into aggregated forms. Spectral data ( b1 and b2 ) include ThT fluorescence emission spectra and corresponding bar graphs for the following conditions: (i) ThT alone (20 μM); (ii) ThT + Aβ 1-40 (2:1, 72 h); (iii) ThT + Aβ 1-40 + I-43 (2:1:4, 72 h); and (iv) ThT + Aβ 1-40 + I-43 (2:1:2, 72 h) in PBS (pH 7.4). Data points are mean ± SEM ( n = 3 independent experiments in triplicate) and ****p < 0.0001. b3 shows ThT-based aggregation kinetics, depicting the time-dependent conversion of monomeric Aβ 1-40 peptides into aggregates in the presence or absence of I-43 over 72 h (mean ± SD, n = 3 indepe n dent experiments in triplicate), and ****p < 0.0001. c , d Comparative analysis of fluorescence intensity changes (Fl spectral and bar graph) of I-43 (10 μM) following incubation with monomeric and fibrillar forms of recombinant tau and α-synuclein (5 μM), relative to Aβ 1-42 and Aβ 1-40 fibrils (5 μM). Data are presented as mean ± SD ( n = 3 independent experiments in triplicate). Statistical significance was determined using one-way ANOVA followed by Dunnett’s post hoc test, and ****P < 0.0001. e , f FMOs and electrostatic potential maps of I-43 obtained from DFT-optimized geometries (Gaussian16). g MTT assay in PC12 cells shows mean ± SEM ( n = 3 independent experiments in quadruplicate; statistical outliers excluded). Source data are provided as a Source Data file.

Article Snippet: For α-synuclein aggregates, E. coli -derived human α-synuclein protein (Met1-Ala140, Cat. No. SP-485-500, batch: DRDU0223121, R&D Systems) was used following a reported protocol with minor modifications .

Techniques: Incubation, Control, Fluorescence, Recombinant, MTT Assay

Journal: Nature Communications

Article Title: Discovery of NIRF theranostic probes targeting amyloid-β and cholinesterases in Alzheimer’s disease models

doi: 10.1038/s41467-025-68282-3

Figure Lengend Snippet: a Paraffin-embedded AD brain sections showed Aβ-positive puncta stained with known standards (ThT, CRANAD-2, and Congo Red). Counterstaining with I-43 revealed high colocalization with these dyes, especially in mature plaques. CAA-associated deposits visualized by Congo Red were also effectively labeled by I-43. b–e Confocal images of AD patient brain tissues co-stained with I-43 (NIR channel) and anti-Aβ antibodies (D54D2, 6E10, OC, and A11; green channel). c1 and d1 Semiquantitative fluorescence intensity analysis of regions of interest (ROIs) determined using ImageJ. Data represent mean ± SD. In panel c1, n = 12; two-tailed unpaired t test ( ns P = 0.466). In panel d1 , n = 9; one-way ANOVA with Dunnett’s post hoc test ( ****P < 0.0001, and *P = 0.0402). f IHC confocal images of PD striatum showing α-Synuclein deposits (pSer129α-Syn antibody); I-43 counterstaining showed no colocalization. g Confocal images of AD and FTD brain sections revealed mature tau tangles (Tau46, AT8 antibodies) with no detectable NIR signal from I-43 in tau-positive puncta. h Confocal images showing CAA-associated staining in the green (OC antibody) and NIR (I-43) channels. Imaging was performed on an LSM 780 (Axio Imager 2) using FITC, TRITC, and 700 nm emission filters for ThT, CRANAD-2, and I-43, respectively. Scale bar: 20 µm. i Confocal images of larval imaginal discs from WT (Oregon R⁺; panels i1 – i2 ) and AD ( ey -GAL4-UAS-Aβ42/CyO; panels i3 – i4 ) flies stained with I-43 ( n ≥ 10). Panels i2 and i4 are 40× magnifications of panels i1 and i3 , respectively (scale bars: 50 µm for i1 / i3 ; 20 µm for i2 / i4 ; λ em = 700 nm; LSM 780). An orthogonal view from panel i4 reveals discrete amyloid plaques. j Fluorescence images of adult WT ( j1-j2 ) and AD ( j3-j4 ) fly eyes after feeding with I-43 (10 µM), acquired at 20× magnification using a NIS-Elements BR microscope (scale bar, 100 µm). White circles indicate ROIs used for fluorescence intensity quantification (red channel). k Semiquantitative fluorescence intensity plot of I-43 in the eyes of WT vs AD flies ( n ≥ 10, mean ± SD, ****P < 0.0001 compared to WT, analyzed by two-tailed unpaired t -test). Source data are provided as a Source Data file.

Article Snippet: For α-synuclein aggregates, E. coli -derived human α-synuclein protein (Met1-Ala140, Cat. No. SP-485-500, batch: DRDU0223121, R&D Systems) was used following a reported protocol with minor modifications .

Techniques: Staining, Labeling, Fluorescence, Two Tailed Test, Imaging, Microscopy